免费高清视频 成人免费视频 成年在线视频免费观看视频

    <pre id="q7rs8"><label id="q7rs8"><menu id="q7rs8"></menu></label></pre>

      1. <pre id="q7rs8"></pre>
        <track id="q7rs8"><ruby id="q7rs8"></ruby></track>
        <acronym id="q7rs8"><label id="q7rs8"></label></acronym>






          出品公司: CAMBIA
          載體名稱: pCAMBIA5105
          質粒類型: 植物載體;農桿菌雙元表達載體
          高拷貝/低拷貝: 高拷貝
          克隆方法: 限制性內切酶,多克隆位點
          啟動子: lac
          載體大小: 49757 bp
          5' 測序引物及序列: M13 Reverse:CAGGAAACAGCTATGAC
          3' 測序引物及序列: M13/pUC Forward:CCCAGTCACGACGTTGTAAAACG
          載體標簽: --
          載體抗性: 卡那霉素、氨基糖苷類抗生素
          篩選標記: Neomycin、GUS
          克隆菌株: HB101等菌株
          宿主細胞(系): 植物細胞、農桿菌
          備注: --
          產品目錄號: --
          穩定性: 穩表達
          組成型/誘導型: 誘導型
          病毒/非病毒: 非病毒





          LOCUS       pCAMBIA5105            49757 bp ds-DNA     circular SYN 25-JUL-2016
          DEFINITION  Plant vector containing vir operons from pTiBo542, compatible with a
                      range of non-Agrobacterium bacteria.
          ACCESSION   EF042581
          SOURCE      synthetic DNA construct
            ORGANISM  synthetic DNA construct
          REFERENCE   1  (bases 1 to 49757)
            AUTHORS   Cambia
            TITLE     Direct Submission
            JOURNAL   Exported Monday, July 25, 2016 from SnapGene Viewer 3.1.4 to Vector 
                      NTI(R) format
          COMMENT     The GenBank record was corrected by adding a C at position 41,557.
          COMMENT     VNTDATE|425520000|
          COMMENT     VNTDBDATE|776304000|
          COMMENT     VNTNAME|pCAMBIA5105|
          COMMENT     VNTAUTHORNAME|Cambia|
          FEATURES             Location/Qualifiers
               CDS             262..699
               CDS             2014..4503
                               /note="sensory component of two-component signal 
                               transduction system"
               CDS             7828..8571
               CDS             10048..10767
                               /note="T-DNA transfer"
               CDS             10782..11147
                               /note="pilin protein precursor"
               CDS             11147..11473
                               /note="T-DNA transfer"
               CDS             11473..13842
                               /note="integral inner membrane ATPase"
               CDS             13857..14519
                               /note="T-DNA transfer"
               CDS             14616..15503
                               /note="T-DNA transfer"
               CDS             15537..15704
                               /note="T-DNA transfer"
               CDS             15691..16404
                               /note="T-DNA transfer"
               CDS             16401..17282
                               /note="T-DNA transfer"
               CDS             17279..18412
                               /note="T-DNA transfer"
               CDS             18452..19483
                               /note="T-DNA transfer"
               CDS             19615..20418
                               /note="response regulator of virA/virG two component 
                               transduction system"
               CDS             complement(20529..21137)
               CDS             complement(21140..21835)
               CDS             22104..22547
                               /note="cleavage accessory protein"
               CDS             22581..23855
               CDS             23875..24513
               CDS             24510..26468
                               /note="coupling protein"
               CDS             26569..29079
               CDS             29529..29726
                               /note="chaperone for VirE2"
               CDS             29731..31380
                               /note="single-stranded DNA binding protein"
               CDS             31447..33465
               promoter        complement(35260..35278)
                               /label=T7 promoter
                               /note="promoter for bacteriophage T7 RNA polymerase"
               primer_bind     complement(35285..35301)
                               /label=M13 fwd
                               /note="common sequencing primer, one of multiple similar 
               rep_origin      35442..35822
                               /label=M13 ori
                               /note="M13 bacteriophage origin of replication; arrow 
                               indicates direction of (+) strand synthesis"
               CDS             36190..36984
                               /gene="aph(3')-II (or nptII)"
                               /product="aminoglycoside phosphotransferase from Tn5"
                               /note="confers resistance to neomycin, kanamycin, and G418 
               CDS             37935..38726
                               /product="aminoglycoside adenylyltransferase"
                               /note="confers resistance to spectinomycin and 
               rep_origin      38970..39558
                               /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
               misc_feature    39744..39884
                               /note="basis of mobility region from pBR322"
               rep_origin      40228..40422
                               /label=pVS1 oriV
                               /note="origin of replication for the Pseudomonas plasmid 
                               pVS1 (Heeb et al., 2000)"
               CDS             complement(40488..41561)
                               /product="replication protein from Pseudomonas plasmid 
                               /label=pVS1 RepA
               CDS             complement(41990..42619)
                               /product="stability protein from Pseudomonas plasmid pVS1"
                               /label=pVS1 StaA
               misc_feature    43919..43943
                               /label=RB T-DNA repeat
                               /note="right border repeat from nopaline C58 T-DNA"
               terminator      43965..44217
                               /label=NOS terminator
                               /note="nopaline synthase terminator and poly(A) signal"
               CDS             complement(44249..44266)
                               /product="6xHis affinity tag"
               CDS             complement(join(44273..46090,46281..46295))
                               /note="codon-optimized Staphylococcus gusA gene with a 
                               catalase intron to ensure expression in plants but not 
               intron          46091..46280
                               /label=cat1 intron
                               /note="castor bean catalase intron, modified"
               promoter        complement(46312..46657)
                               /label=35S promoter
                               /note="strong constitutive promoter from cauliflower mosaic
               CDS             complement(46891..47130)
                               /gene="lacZ fragment"
                               /product="LacZ-alpha fragment of beta-galactosidase"
               primer_bind     47034..47050
                               /label=M13 fwd
                               /note="common sequencing primer, one of multiple similar 
               primer_bind     complement(47126..47142)
                               /label=M13 rev
                               /note="common sequencing primer, one of multiple similar 
               protein_bind    47150..47166
                               /label=lac operator
                               /bound_moiety="lac repressor encoded by lacI"
                               /note="The lac repressor binds to the lac operator to 
                               inhibit transcription in E. coli. This inhibition can be 
                               relieved by adding lactose or 
                               isopropyl-beta-D-thiogalactopyranoside (IPTG)."
               promoter        complement(47174..47204)
                               /label=lac promoter
                               /note="promoter for the E. coli lac operon"
               promoter        47431..48108
                               /label=35S promoter (enhanced)
                               /note="cauliflower mosaic virus 35S promoter with a 
                               duplicated enhancer region"
               CDS             48176..49201
                               /product="hygromycin B phosphotransferase"
                               /note="confers resistance to hygromycin"
               polyA_signal    49241..49415
                               /label=CaMV poly(A) signal
                               /note="cauliflower mosaic virus polyadenylation signal"
               misc_feature    49493..49517
                               /label=LB T-DNA repeat
                               /note="left border repeat from nopaline C58 T-DNA"
                  1 taatctacct gtgacactaa gatgatcgaa gccactttcg ctcaggagtt atcacgttaa
                 61 ggcgcaactc ataaaaatgc gtcaccgatt acttgatgcg cacgcttact atatctcaaa
                121 tcaaatgtcg aacctcggtt gaagcccatt gtctacgtcg cgtatatctc ccgtattttg
                181 cttttgctgc cgaccgatac cgctgcggtt caatagttgc ggaatgtggt gctttcggat
                241 tcactcaaaa aggagtcgct tatgaaacgt atcagtacaa tccttgtcgg cgtatttttg
                301 gctgcgccgg tttatgcagc cgacaatatt catacattag ggacgttgtc tgaaattgaa
                361 ctagcgctca ctgccggaaa gccggtgaac gtcacggttg atttaagttt gtgtgctccc
                421 ggggtggccg atactccggc gacgaaaacg caaggaggca tgcgcataga tgcgtatcga
                481 ataacaactg acggcaccct tgcgtttgca gatcagcact tcaccattga ccgtgacggt
                541 aaacccataa ctcaatttat tcgttatcag attcggtcaa acggtgacgc cgatttcacg
                601 atggttacat tcaacatgcc aacatatgag cgaaaaggta ccagcttggc ctacaagtgc
                661 gcgatcgacc acgggttgag ttttcgtact ccacagtgat ttttgcgtcc aatctgatcc
                721 gatgcaagcc caaggtgacg cttgcaatta cccacatttg agcgtcgctg ccatttcggt
                781 tctgaggcga atatctgtca gccggctgag tccacgccag acgaccgtat ttcccggagg
                841 aggatctgaa gttctagcaa ggttgccacc caaacgagcg agtttggtga gatagaagtt
                901 tagcgattcg caacgaagca cgaccgcaga accacttact tcgaaggctt cgtatatatc
                961 gttcctgcag tgatctggct gcgatgaatg tcgattcgtc ctggtggtag catcagggat
               1021 agtcctacga cgaagcatag gatttaagtc atcacgtctg ttaaatgccg ccggcgctgg
               1081 ccacgcgaag acaaagagcg cctcgtcgct gcctgctttg agccgggcgc agttatctct
               1141 gagattgcct gcgcggacgg tatcaatgtc agtcagtcgg aagcatagcg atgtaataat
               1201 caagttgggt cgggaccgac gtgtccgcgt ggatagcaac atcgacacgg aagcacttgg
               1261 ccgtattctc gattgcgtgc tggggctgcg atgatcatgg tccctgctgg tgtgaaggtc
               1321 tggcaggcaa cgggctccac cgacatgcgc aaaggcttcc ccggtctgtc gttgatcttg
               1381 cagaaagcac tgatgcctga cccgaggtgt gggcactgtt cgtattatac ggtcgtggcg
               1441 gccaacgacc gacatactgc atacggatat cgtttcgcga cgatctccta cagccgtcaa
               1501 agctttcgag cgcaagcgcc catcacgcaa actcttcccg gttcatctgt cgcgtgagcg
               1561 tgtcgttatc gccaccccta cgaactgtgc ttgctgcgaa tccgccaaac tgtcatagct
               1621 tggcgaggat gttaccgaga cccttggaag tcatccgaga tttggcggcg gcaacctctg
               1681 caaaatgcgt tatgagcctg gtttttcagc cacagacaag tatcgcgttc gtgaaaaagc
               1741 gcacgcgcga tagttcttta gccgcacctc tgacgcccca tttacggccg gatctttgcc
               1801 tgaccttgca aagtcgactc catcgcctta cggcacgaat aacaacgtcg cgtttcatcg
               1861 acgtcccatc agccgcttgt gtgttcaatt cttctctgtt tcacttgaaa caaattgaat
               1921 agatattccc gctttcaaag ccatttacaa atcctctcgt gcagcctaac gccattggcg
               1981 tggaacaagc gttggcacga ggaagtaagt gcgatgaacg gaaggtattc accgacgcgg
               2041 caggatttta agacaggcgc gaagccttgg tctatattag cccttatcgt tgccgcaatg
               2101 attttcgcgt tcatggcggt tgcgtcctgg caggacaatg ggactaccca ggcaatcctt
               2161 agccaaatac gatcgattaa cgctgacagc gcctcactgc agcgcgatgt actccgcgct
               2221 cacacgggca ccgtggcgaa ctaccgcccc attatctcca ggctgggagc tctgcggaag
               2281 aatctggaag atttgaagca attatttagg caatctcata ttgtaagtga gagcaatgct
               2341 gctcaactgc tacgccggct agaagtgtct ctaaattcgg ctgacgcggc ggtcgccgcc
               2401 tttggtgcgc aaaatgtccg cctgcaagat tcgctggcca gtttcactcg tgctttaagc
               2461 aatcttccag gaaaggcctc aagcgatcag actttagaaa aaccaacaga attggctagc
               2521 atgatgctcc aatttcttcg gcaaccaagc ccggctattt cattcgagat cagccttgaa
               2581 ctagagaggc tccaaaaaca acgcggtctt gatgaagctc ccgtgcgcat actttcgcgt
               2641 gaaggtccca ttatcttatc gcttttgcca caggtgaacg atctggtgaa catgattcag
               2701 acgtctgaca ccgcagaaat tgcggaaatg ttgcagcgtg agtgtttgga ggtctatagc
               2761 ttgaaaaatg tggaggagcg gagcgcacgt atctttcttg ggtccgcttc agtgggtctt
               2821 tgcctgtaca tcatcacctt agtctatagg ctacgcaaaa aaaccgattg gttagcgcgg
               2881 cgtttagatt acgaagagct aatcaaagag atcggagtat gttttgaagg tgaggcggcc
               2941 actacgtcgt ccgcgcaagc tgcacttggt attattcagc gcttctttga tgccgatacg
               3001 tgcgcgttag ctctagtgga ccatgaccgt aggtgggctg tcgaaacatt cggtgcgaag
               3061 cacccaaaac ccgtgtggga cgacagggtg ctacgcgaaa tagtctctcg taccaaagcg
               3121 aacgaacggg cgacggtatt ccgcatcgta tcgacgcaaa aaatcgtaca tttgcctccc
               3181 gaaattccag gtctttcgat actactggct cacaaatcca cagataaact aattgcggtt
               3241 tgttcactgg gttaccaaag ctatcgccct cgaccttgcc aaggcgaaat tcagcttctt
               3301 gaactcgcca ccgcctgcct ctgtcactat atcgatgttc ggcgtaagca gaccgaatgc
               3361 gacgttttgg ccagacgatt ggagcatgcg caacgccttg aggcagttgg tacacttgcc
               3421 ggcggaatag cacatgaatt taataacatt ttggggtcaa tcctcgggca cgcagaattg
               3481 gcccaaaact cggtgtctcg aacatctgtc acccgaagat acattgacta tatcatttcg
               3541 tcaggcgaca gagccatgct cattatcgat cagatcttga cgctgagccg aaaacaagag
               3601 cgcgtgatca agccatttag tgtctcagag cttgtgaccg aaatcgctcc cttgctacgt
               3661 atggctcttc ccccaaccat cgagcttagt ttcagatttg atcaaatgca gagcgtgatc
               3721 gaaggaagcc cgcttgaact tcaacaggta ctaattaacc tctgcaagaa tgcttcccaa
               3781 gccatgactg caaatggtca aatcgacatc ttcgtcggcc aagcttattt accagctaag
               3841 aaaattctgg cgcatggtgt tatgccacct ggcgactatg ttctactatc tgtcagcgac
               3901 aatggtggag gcatttcaga ggctgtgcta ccctacattt ttgaaccctt ctttacgaca
               3961 cgtgctcgca acggtggaac gggtctcggc ctcgcttctg tgcatggtca tatcagcgcg
               4021 tttgcaggtt acatcgacgt tagttcaact gttgggcatg ggacgcgctt tgacatttat
               4081 ctccctccgt cttctaagga gcccgtcaat cccgacagct ttttcggccg caataaggca
               4141 ccgcgtggaa acggggagat tgtggcactt gttgagcccg atgacctcct gcgggaggcg
               4201 tatgaagaca agatcgccgc tctgggatat gagccggtcg gttttcgtac ctttagtgaa
               4261 attcgcgatt ggatttcaaa aggcaatgaa gccgatctgg tcatggtcga ccaagcgtct
               4321 cttcctgaag atcaaagtcc taattccgtg gatttagtgc tcaagaccgc ctccatcatc
               4381 attggcggaa atgatctcaa aatgcccctt tcaagggaga atgcgaccag ggacctttat
               4441 ctgccgaagc cgatatcgtc cagaactatg gcgcatgcaa tcctaaccaa aatcaagacg
               4501 tagagttgcg acgtatcagg actgggcaat cagatttcgg ttcggtggag cgcgacaggg
               4561 gaactacatg aaagatcgaa cggcataggt tcaatggatc aagccgggcg aggcggcttg
               4621 atttgtccga tcaggtccgg tcgtttggtt gaaaggattt gcgcaccaac tatgacacca
               4681 ccatcattgg tgccagcaga ttaaagtagg cctgaaccgg tgcggtcaaa aatcggggtg
               4741 gacgtcggct attgtacagg tcagattgct gccaaatgcc gacgcgggaa ttgggcacgg
               4801 tgtcgtaagc gtggacagag attacctcgt cgttgatcga acacgagagc catctgacga
               4861 acaccttatg ccgccaccca ttaacatcca ctgcgattct cgtcttcttc agcacgagca
               4921 tgaagtctca agaagtaaac ttcgagcgtt ggtcagccta taagatgagt tcgccagaaa
               4981 gggcaggcgt tcgcgcctcc ctcaatgcag aaggctactt ccattgtggt cggcaactgc
               5041 caggatggga actctcccga taatccaacc aacgacagcg cagtggtaaa gtaagcggca
               5101 agctgacccc atctggcgtc agtagcgcgg gctcagctat tgcgtaatga ctatccacca
               5161 gctgtgagct tctatgtctg cgcctatctc tggaactaga aactttcata tgatcgaggc
               5221 cgttccggaa cgtttcgagg gcgcgccgcg gcagtttcgg cggcgttggt ccgatgactt
               5281 caaggagcga gcggtggctg aggcaatgga gcctggagcg agtgtctcgg caattgcgcg
               5341 tcgcatcggc atacatccat cacaattatt cggctggcgt cgtgatgctc gcgccaggca
               5401 agggggctct tcggtgcctg cggctgtcga ggcgtgtttg gggccagttt gtgcgcgggc
               5461 ggtgatcgag gtggttatcg gcgacatgat tatccgggcg gggatggatg ccgatgaagc
               5521 acacctcagt cgcgtgatcc gagtggtgcg gtcggcatga tcccgtcgaa cgtaaaagtc
               5581 tttctggcga gccatccgat cgacttccgt aagggacctg acagcttgct atcactggtt
               5641 cgagatgctg gcagtgatcc gttcaacgga gctctttatg tcttccgggc gaaacgagca
               5701 gaccgtatca agatcgtatg gtgggatggc tccggcgttt gcctttacgc caagcggctg
               5761 gagaaagccc agttctgctg gccgcgcatc ggacatagcc gggtccagct caacaatgcc
               5821 cagcttctgg ctttggtgga tgggatggac tggaaacgcg ttcgatcaac acccatcaag
               5881 ccgccagaga ttgttgggta aaacccctgc ggcgaattga atcatgcacc tgaaactgcg
               5941 ggcggatcac agcaaaatat gctctgatca tacccatgac gcgacccgat atagagctcc
               6001 cggatgatgt agaggcactc aaggccatgg ttcttgccat ggccgaaaag gccgctcgtg
               6061 tcgaggcttt ggaaaagcag gtcgatgatc tcgaggcccg aagtgctgac gccgatgagc
               6121 gcatcgagcg gctgacacag atcctgaaag cttttgaccg cgcgcgcttc ggacggcgtt
               6181 cagagaaact tgcagcggcc agtgccgatg acgagcagca tgcttttgtc tttgaggaga
               6241 tcgagaccgg tattgcggcg atcagggcca aggttacgag tggcatcaac aaagatggca
               6301 aacgtccacc gaggccacgc aagggctttg cggcgcatct ggagcgtatc gaggtggtga
               6361 tcgagccgga agacttgccg gagcatgcgg gtaagaccaa aatcctgatc ggagaagaca
               6421 tatccgaacg cttggatgtc gttgcagcga agttccgtgt cattgtcacg cgccgtccca
               6481 aatacgcttt taagaacgaa gatggcgtga tccaggctgc ggccccgaca catatcattg
               6541 aggcgggtat cccaaccgaa gcgcttctgg cccagatcgc cgtctccaaa tatgccgatg
               6601 gcctcccact ctatcggcaa gaagcgatct acgcccgcga caaggtcgac cttgaccgca
               6661 ggctcatggc tcaatggatg ggaaagctgg ggttcgagct cgacatcctc gccgattata
               6721 tcctgaacga aatcaagaag gcggaacgaa tatttgccga cgagacgacc ctgccgacac
               6781 tggcgcctgg atccgggtcg gcgaaaaccg catggctatg ggcttatgcc agggatgacc
               6841 gaccgttcgg aggcaacagc cctccaatgg tggcctatcg cttcgaagac agtcgggcga
               6901 acgactgcgt ggcacggcac ctcagcggct atcgcgggat tctgcaggtt gacgggtacg
               6961 gggcctacag caagcttgtc cgcaaggacg gcggcaacga cggcgttatt ctggctggct
               7021 gctgggccca tagccgtcgc aagttctatg aattgcatgt cgcgaaaagc tccaaggtgg
               7081 caacagagac agtcgagcga atggcaacgc tctgggaaat agaagatacc gtccgcggcc
               7141 aaagccctga ggcgcgtgtc gctgcccgac aagaccgctc ggcggcgata gtccgggacc
               7201 tcttcactct ctggcagacg actttgccgc gagtatcagg caaatccaaa ctcgccgaag
               7261 ctctacggta ctcgatcaag cgtcgtgacg tcttcgaacg ctttctgacc gacggccgtg
               7321 tcgagctcga ctccaacatc gtcgagcgag cgatcagacc gcaggcgata acaagaaaaa
               7381 atagtctctt cgccggcagc gacggcggcg gcaagacatg ggcgacaatc gcgacacttt
               7441 tgcagactgc aaaaatgaat tctgtcgatc cccaggcctg gctgacgcag acgctcgagc
               7501 gccttgcaaa cggctggcct agcagcgaaa tccataccct tatgccgtgg agctacaagg
               7561 cctgaacggc ctcagcttgc cgcttacgtg gtaaacagag ccaccccatc aggaatatcg
               7621 cccattccgt catcagcgtg gtgacgtgca tcaggcgcgc ttgttgcaga actttaagtg
               7681 cttctttcga ttcgagatct cagcaaaagt tctccgcaaa ccttcaccgc gggcttacgt
               7741 gtcttttgta acaaattgcg acgcagttga tatccacttg aaacattagt ccgaaattat
               7801 cgagatctcc gctgataagg tatcgaaatg gcgataaaat tggtattgat actcgtattc
               7861 acactctttc ccgcggcaga cgctgcatat gcgaatgacc gcgccaacgg tttcatgtgg
               7921 tcaaacgggg gcgaaactgg agtgaggctt cctcttcggg tgttcaatgc caagccagcc
               7981 aagaacacgg tggcgatcat ttattccgga gacgctggat ggcaaaatat cgatgaggcg
               8041 attggtacct atctgcagac ggaagggatt cctgtcattg gcgtcagttc acttcggtat
               8101 ttctggtcgg agcggtcccc aagcgaaact gctaaggatc ttggtcacat aatcgatgtc
               8161 tacaccaagc atttcggtgt gcagaatgtt ttacttgtag gatattcttt cggcgcggac
               8221 gtcatgccgg caagcttcaa taggcttacg cttgagcaaa aaaatcgggt taagcaaatc
               8281 tctctcttgg cattgtcaca tcaagtcgac tatgtcgtct catttagggg ctggctccaa
               8341 ctcgaaacgg aaggtaaggg cggcaatcct ctggatgatc tcagatccat tgaccctgca
               8401 atcgtccaat gcatgtacgg gcgcgaagac cgtaataatg cttgcccatc tctccgacag
               8461 accggcgcag aggtgatagg cttcagcgga ggccatcact ttgataatga tttcaaaaaa
               8521 ctgtctacgc gcgtcgtctc aggcctcgtg gcacgcctaa gtcatcagta atctttagtt
               8581 cctgcaccgc tttagtattg actgggatag cgacgcctgt gatgcagaca tcggatattg
               8641 tgtcgttaag taaaaggcct tcgtctgatc gcgagactcg ctagtggttt tcaggtgagt
               8701 gagatgtttt gccgcaagtt gcgctgagat cgcatctgcc tgcggctgcc gcacctccag
               8761 attggcagca acaagatcat ccttcaaggg aagatgccta taacgcatgt gttgacgact
               8821 ttcgcctcgt gaatgatccg gtctgttccc gacagtggga tgccgtcgcg atagagcagg
               8881 ctctcgcgcc aggaggaatt tctccgatat gacttctctc cttctacgtg cccaaagcag
               8941 caacgaaatc atctatcgcg gccaaaagag cggtcatgtg aaagcaccct tgccagtcaa
               9001 ttccctggcc aaggtcagca cggcgatact gcgaggtgtt gctacaccac ggaggcgatc
               9061 tagaaggacg atttcatcat ttaggccgca cactcataaa tcaggtttgc aaatcggtct
               9121 gattttgatt cattgaggct tgacttggag gccactgata acccgtcccc gctttgatgt
               9181 caccgatttc gaatggactg ttgttcagtc ctttgttccc aaataagccg cgtcgcgtgc
               9241 cgcgcgttga cgcgggtgat caatgtcatc ttgtggcgct tccggacggg cccgccctgg
               9301 gcagacgttc ctgatcgata cggttcctgt acaacctgct acaatcgctt tgtacgatgg
               9361 cgtgaggcag acgtctggga tcatattctg agtgtgattt ccaaggcttt cgatagaatg
               9421 tcgtcatgat tgacagttcc tgtgtccgcg tccaccaaca tgcggcgacg ggaaacagcg
               9481 ggatcaagac gatggctgta tgggacgttc ccgtggcggt ttgaccacca agattcacgc
               9541 tgttgtcgat gccgacggtt gaccgatccg tcttgcgctg acagcgggtc aagcccatga
               9601 ccgccgcatg accgaaacat ttttacaaat aatcgcttag agtgcgtttc tgctggcgga
               9661 caaggcatat gataccaacg cgataagagc atttgcaaag cgcaagcagg catgggccaa
               9721 tattcctgcc aagagcaatc ggaaggaagc ttcccgttca tcgaatgggt ttacagacag
               9781 cgtaacctcg ccgagcattt tcgttctgag cctgacctga ccaactgcgg cctgaatagg
               9841 tcgatccggt tgcttagtca tggatgcgcg gttctcggtc catgttgcgt tccaagacgc
               9901 cgggcgaggt ttctcgcttc aattgaaatc ataaagaagc aattgaaaat tttcgagtaa
               9961 ccgaccctcc cgataatctt caacataaaa caacgcactt cttccaacgg gagaggcggt
              10021 gttagttgcg agctaaggag ataaggtatg cttaagagat cggggtcgct ttctcttgcc
              10081 ttgatggtct ccttctgttc gtcgagcctt gccacgccac tctcatctgc tgagtttgac
              10141 catgttgctc gcaagtgtgc cccatcagtt gcgacatcta cgcttgcggc gatagctaag
              10201 gtggagagtc gctttgatcc tttagcgatt catgacaaca cgaccggcga aacgcttcac
              10261 tggcaagatc acagccaagc aacccaagtc gtcaggcgcc gtctcgatgc acggcattcg
              10321 ctggatgttg gcctcatgca aataaactct cgaaattttt ctatgctcgg tctgacacct
              10381 gacggtgcgc tccaggcgtg cacatcatta tctgccgctg caaacatgct gaaaagtcgt
              10441 tatgcaggcg gcgaaacgat tgacgagaag caatttgcgc ttcgtcgggc gatctccgct
              10501 tacaacaccg gtaatttcat cggcggtttt gcaaacggct acgtgcgaaa agttgaaaca
              10561 gctgctcaat cgctggtgcc cgcgttaatc gagcctccaa aagacgatca cgaggcgcta
              10621 aaatccgaag agacgtggga tgtttggggg tcatatcagc gccgctcgca ggaggatggc
              10681 gctggcggtt taatcgctcc gccaccgcca caccaggaca acggcaaatc cgcagacgac
              10741 aatcaagtct tattcgactt atactaagga ggtgcgcatt gatgcgatgc tttgagagat
              10801 accgtttaca tctaaatcgc ctctcgctct cgaatgcgat gatgcgcgtg atatcgagct
              10861 gcgccccaag cttgtgcggt gcaattgcat ggagcatttc ctcatccgga cccgccgcag
              10921 cgcaatctgc gggtggcggc actgaccccg ccacaatggt taacaatata tgcacgttta
              10981 tccttggtcc gttcggccag tcactcgctg ttctcggcat tgtcgctatc gggatctcct
              11041 ggatgttcgg gcgggcttcg cttgggctgg ttgccggcgt cgtcggcggc attgttatca
              11101 tgtttggggc gagcttcctc ggccaaacgc tcactggcgg tagttgatgg ctgatcgttt
              11161 ggaagaatcg accctttacc tcgcagccac acggcccgca ttgtttcttg gggtgccact
              11221 gacattggca gggttattca tgatgttcgc cggctttgtc atcgttatcg ttcagaaccc
              11281 gctctacgaa gtcgttctcg tgccgttatg gtttgcagcc cggctcatcg tggagcgaga
              11341 ctacaatgcg gcgagcgtcg tcctgctatt tttgcggacc gcgggaagaa gcattgatag
              11401 tgcagtttgg gggggcgcta ctgttagccc aaatccaatt agggttcccc cacgagggag
              11461 aggaatggtg tgatgctcgg cgcgagtgga acgaccgaaa gatccggtga gatctatctc
              11521 ccttatattg gccacctcag cgaccatatc gtccttcttg aagacggatc gatcatgacc
              11581 attgcgagaa ttgatggcgt tgcattcgag cttgaggaaa ctgaaatgcg caatgcgcgt
              11641 tgtcgtgcgt tcaacacgct gttgcgcaat atcgctgatg atcatgtgtc aatatatgct
              11701 cacctcgtac gtcatgccga cgtgccatca tcggcgccgc gacacttccg tagtgttttc
              11761 gccgctagcc tgaacgaagc ttttgaacag cgcgtgctct ccggccaact cctccgcaat
              11821 gaacacttcc ttacgttgat tgtctaccca caggcggctt tagggaaggt aaagaggagg
              11881 ttcaccaagc taagcggaaa aagggaaaac gatctcacgg gccagatcag gaacatggaa
              11941 gatctttggc atgttgtcgc tggctctctt aaagcgtatg gcctgcatcg tcttggcatc
              12001 cgcgagaagc agggtgtgct cttcaccgaa attggcgaag cgctacggtt gatcatgact
              12061 ggtcggttca caccggttcc ggtcgtcagc ggctcactcg gcgcttcgat ttataccgac
              12121 agagtcattt gcggcaagcg aggactcgag atcagaacgc caaaagacag ttacgttgga
              12181 tccatctatt cgtttcgcga ataccctgca aaaacacggc cgggcatgct caacgcgctg
              12241 ctatccctcg attttccact tgttctcacg cagagttttt cgttcctgac tcgcccgcaa
              12301 gcgcacgcga aacttagcct caaatcgagc cagatgctga gttccggcga taaagccgtg
              12361 actcaaatcg gcaaattatc cgaggctgag gacgcacttg cgagcaacga attcgttatg
              12421 ggctcacatc atttgagcct ttgcgtctat gcagacgatc tcaatagtct tggggacagg
              12481 ggcgcgcggg ctcggacacg aatggcggat gcaggtgccg tggttgtcca agaaggtatt
              12541 ggtatggaag cggcctattg gtcccaattg ccggggaatt ttaagtggcg cacacgccct
              12601 ggcgcaatca cttcacgcaa tttcgcaggg tttgtctctt tcgaaaactt tccagagggc
              12661 gccagctcag gccactgggg caacgcgatt gcccgatttc gtaccaatgg cggaacgcct
              12721 ttcgactata tcccgcatga gcacgatgtt ggcatgacgg caatattcgg gcctatcggg
              12781 aggggtaaga cgacgctcat gatgtttgtt ctagccatgc tcgaacagag catggtcgac
              12841 cgtgcaggta cggtcgtgtt ctttgacaag gaccggggtg gcgaattgct ggttcgcgcc
              12901 acaggaggaa catatttggc acttcacaga ggcacaccca gcgggttggc gccgttgcgt
              12961 ggcctagaaa acacagcagc ctcacacgat tttctgcgcg aatggatcgt ggctctcatc
              13021 gagagtgatg gtcggggtgg gatttctccg gaagagaacc gccgtctggt ccgtggtatc
              13081 catcgtcagc tctcgtttga tccacaaatg cgttcaatcg cggggttacg tgaatttttg
              13141 ttgcatgggc ccgccgaagg cgcaggagcg cggctccaac gctggtgccg gggccatgcg
              13201 cttggctggg catttgacgg cgaagttgac gaagtaaagt tagatccgtc gattaccggc
              13261 ttcgacatga cgcatcttct cgaatacgag gaagtatgcg ctcccgctgc agcatatctc
              13321 ctgcatcgga ttggagccat gatcgacggc cgccgttttg tgatgagctg cgatgagttt
              13381 cgcgcctatt tgttaaaccc taaattttcg actgtcgtcg acaaattcct cctgaccgtt
              13441 cgaaaaaaca acgggatgct aatactggca acgcagcaac cagagcatgt tctggaatcg
              13501 ccgctaggag ccagcttggt tgcgcaatgt atgacgaaga ttttctatcc atcaccaacc
              13561 gcagatcgat cggcttatgt cgatggactg aaatgtaccg aaaaggaatt tcaggcgatc
              13621 cgtgaagaca tgacggtcgg cagccgtaag tttcttctta aacgagaaag tggaagcgtc
              13681 atctgcgaat ttgatctgcg ggatatgcgt gaatatgtcg ccgtgctttc ggggcgtgcc
              13741 aacacggtgc gctttgcaac tcgactacgc gaggcacaag aaggcaactc atctggctgg
              13801 ctcagcgaat tcatggcccg tcaccacgag gcagaagatt gataaggtag gaaacgatga
              13861 agacgacgca acttattgca acagttttga cctgcagctt tctatatatt cagcccgcgc
              13921 gggcgcagtt tgttgttagc gacccggcaa cggaggctga gacgctcgcg actgcgctcg
              13981 cgactgcgga gaatctcact cagactatag cgatggttac gatgttgacg tcggcctacg
              14041 gcgttactgg actactgact tcgctcaacc agaaaaatca gtatccttcg acgaaggacc
              14101 tagacaatga aatgttttcg ccgcgaatgc caatgtcgac cacggcacgt gcgatcacca
              14161 gcgatacaga tcgtgcagtc gtgggtagtg atgctgaagc ggacctgttg cgatcgcaga
              14221 tcaccggttc cgcaaacagc gctggcattg cggctgacaa tctggaaacg atggacaaac
              14281 gcttgacggc gaatgctgat acgtctgctc agctttcccg atctcgcaat atcatgcagg
              14341 caaccgtgac caatggtttg cttctcaagc agatccatga cgcaatgatt caaaatgtac
              14401 aggcgacaag cctattaacg atgactaccg cgcaggccgg ccttcacgag gcggaagagg
              14461 cggccgctca acgcaaggag catcaaaaga ccgctgtcat ctttggtgcc ctcccctaag
              14521 gctgggcgat ttgttcatcc gcccgcatcc tcgccgaatg cgagctcatt ttatccaaca
              14581 ttatgcgaca aaccagtcaa gttcaggtcc aatcgatgaa tttcacgatt ccggcgccgt
              14641 ttacggccat tcatacgatc ttcgatgtag ccttcacgac aggcttggac tcgatgcttg
              14701 agactatcca ggaggcggtg agtgcgccat tgatcgcctg tgtcactctt tggattattg
              14761 ttcagggtat tttagtcata cgcggcgaag tcgatacccg tagcggtatc actcgggtga
              14821 tcacggtcac catcgttgtt gctctaattg ttgggcaggc taactaccaa gactatgtgg
              14881 tttccatctt cgaaaagacg gtcccaaact ttgttcagca gtttagtgta accggcttgc
              14941 ctctgcagac tgttccggca cagttggata caatgttcgc cgtgacccag gccgtttttc
              15001 agaaaatcgc atccgaaatc ggtccgatga acgaccagga catccttgct ttccaagggg
              15061 cacagtgggt cctttacggc acgctctggt ctgccttcgg agtttacgac gccgttggaa
              15121 ttctcacgaa agtgcttctc gcgatcgggc ctctgatcct cgtcggatat atttttgatc
              15181 gcacgcggga catcgcagct aagtggatcg ggcaacttat cacctacggt ctcttgcttc
              15241 tcctcttaaa cctcgtggca acgatcgtca tcctaaccga agcgactgcg ctcaccctta
              15301 tgcttggtgt aatcaccttc gccggtacga ccgcggccaa gatcattggt ctttacgaac
              15361 tcgatatgtt ttttctgaca ggggatgcgc tcattgtcgc tttgccggcg atcgccggca
              15421 acattggagg cagttactgg agcggcgcaa cccaatctgc cagcagcttg taccgtcgct
              15481 tcgctcaggt tgagcgaggc taggtcgcgc aaaaattcgc ctcaatggag aattctatga
              15541 agtattgcct gctgtgccta gttgtcgctt tgagcggctg ccagacaaac gacacattag
              15601 cgagctgcaa aggcccgatc ttcccgctga atgtggggcg atggcagcct actccgtcag
              15661 atcttcagct cggcaattcg ggtggacgct atgacggggc ctgaatatgc catgctagtg
              15721 gcgcgcgaaa gccttgccga gcactataag gaagtagaag cctttcaaac cgcgcgagcg
              15781 aaatcggcgc gacgtctctc caaactcatt gcagctgtcg cagctatcgc gattttggga
              15841 aatgttgctc aagcgttcgc tatagccaca atggtgccgt tgagcaggct tgtgcccgta
              15901 tatctatgga tacggccgga cggcaccgtt gacagcgagg tgtctgtctc gcgattgcct
              15961 gcaactcaag aggaggccgt cgttaacgcc tcattgtggg agtacgttcg cctgcgcgag
              16021 agttatgatg ccgacaccgc tcagtacgcc tacgacctgg tatcgaactt cagtgcccca
              16081 acagtgcgcc aggattacca gcaattcttc aactatccca atcccagttc gcctcaagtc
              16141 attcttggca aacgcggcag ggtggaggtc gagcacatcg cttcaaatga tgtaactcca
              16201 agcacgcagc aaattcgcta taaaaggacc ctcgtcgttg acggcaaaat gcctgtggtg
              16261 agtacgtgga ccgcgacagt tcgctacgaa aaggtgacca gcttgcccgg cagattgaga
              16321 ctaaccaacc cggcaggtct ggttgtcacc tcctatcaga catcggaaga taccgtttca
              16381 aacgtaggcc acagcgaacc atgatcagaa aagcactttt cattttagca tgtttatttg
              16441 ccgctgcgac tggtgcggag gctgaagaca ctccaatggc gggcaagcta gatccgcgca
              16501 tgcgttattt ggcttacaat cccgatcaag tggtgcgcct ctcgacggcg gttggagcta
              16561 ctttggtcgt aacattcgcc acgaacgaaa cggtgacagc ggttgccgtt tcaaatagca
              16621 aagatctagc agccctaccg cggggaaatt atctattttt caaggcaagc caggtcctca
              16681 cgcctcagcc agtaatcgtg ctaaccgcaa gcgactccgg gatgcgccgt tatgttttca
              16741 gtataagttc caagactctg tcccacctcg ataaagagca gcccgatctc tattacagcg
              16801 tccaattcgc ctaccccgcc gacgatgcgg cggctcggcg aagggaggca caacagaagg
              16861 ctgttgtgga cagactacac gcggaagcac aatatcaacg gaaagctgag aatttattgg
              16921 atcagcctgt cacagccctt ggtgcggcgg acagtaattg gcactacgtc gcccaaggcg
              16981 atcgttcgct gttgccactc gaagtcttcg acaatggatt tacgacggta ttccactttc
              17041 cgggcaatgt acgcataccc tccatctaca ccatcaatcc tgatggcaag gaagctgttg
              17101 ccaactattc agttaaaggg agcgatgtcg agatttcttc ggtttcccga ggttggcgtc
              17161 tgagggatgg ccacacagta ctatgtatct ggaacaccgc ttacgatccc gttggccaaa
              17221 ggccgcaaac gggcacggtg aggcccgatg tgaaacgcgt cctgaagggg gcgaagggat
              17281 gaataacgat agtcagcaag cggcacatga ggttgatgca tctggatccc tggtctccga
              17341 caaacatcgc cggcgtcttt cggggtctca gaaattgatc gtcggaggtg tcgttctcgc
              17401 gttatcatta agcctcattt ggctaggtgg gcgccaaaag aaggtgaatg agaacgcatc
              17461 gccgtcaact ttgatcgcaa caaacaccaa gccatttcat ccagctccga ttgaggtgcc
              17521 gccggatcct ccagcggttc aagaggctgt tcagcctgct gctcctctac cgccgagggg
              17581 cgaaccggag cggcatgagc cacggccgga agaaacaccg atttttgcat atagcagcgg
              17641 cgatcaaggg gtcagcaaac gcgccattca gggcgacacg ggccgaagac aagaaggcaa
              17701 gcgtgacgac aactccttgc cgaatggcga agtgtccggc gagaacgatt tgtcgatacg
              17761 tatgaaaccc accgagctgc agcccagcag cgccacgctc ttgccgcacc ccgattttat
              17821 ggtaacgcaa gggacaataa ttccgtgcat cttgcaaacc gcaatcgaca caaatttggc
              17881 aggctatgta aagtgtgtct tgcctcagga tattcgtgga acaacgaaca atatcgtgct
              17941 tcttgatcgt ggcaccaccg ttgttggcga aatacagcgt ggcttgcaac agggagatgg
              18001 gcgcgttttt gtgttgtggg atcgcgccga gacacctgac catgcgatga tctcgttaac
              18061 atcgccaagc gcggacgaac tcggtcgctc aggattgccg ggctcggtcg acagccactt
              18121 ctggcagcgt tttagcggag ctatgctctt gagtgttgtt caaggcgcct tccaggcagc
              18181 tagcacctac gccggcagct cgggtggcgg gatgagcttc aacagctttc aaaataacgg
              18241 tgagcagaca actgagacag cccttaaggc aaccatcaac ataccgccaa ccctgaagaa
              18301 gaatcagggt gacaccgttt ccattttcgt agcacgggac ctcgatttct ttggtgttta
              18361 ccagctccgc ctgactggcg gcgccacgcg ggggaggaac cgccgctctt aatgaattca
              18421 aatttccgct tagagatagg atacattgta aatggaagtg gatccgcaac tacgctttct
              18481 tctgaagccg attttggaat ggctcgatga cccgaagact gaagaaattg cgatcaatcg
              18541 acctggagag gcatttgtgc gccaagccgg catttttacc aagatgcctt tgcccgtctc
              18601 ttatgatgat cttgaagata tcgctatttt agcgggcgcg ctgagaaagc aggatgtcgg
              18661 accacgtaac cccctctgcg ccactgaact tcctggtggt gaacgactac aaatctgtct
              18721 gccgccgacc gttccctcgg gcaccgtcag cttgaccatt cgacggccaa gctcgcgtgt
              18781 ttctggtctt aaagaagtct cctcccgtta tgatgcttcg aggtggaacc agtggcagac
              18841 acgaaggaaa cgccaaaatc aggatgatga agctatcctt cagcattttg acaacgggga
              18901 tttggaagcg tttctgcacg catgcgtcgt cagccgactg acgatgttgc tatgtggccc
              18961 taccggaagc ggcaagacaa caatgagcaa gaccttgatc agcgccatcc ccccccagga
              19021 aaggctaatc accatagaag atacgctcga actcgtcatt ccacacgata atcatgttag
              19081 actactctac tccaagaacg gtgctgggct gggtgctgtg agcgccgagc acttgctcca
              19141 agcaagtctg cgtatgcggc cggaccggat attgcttggc gagatgcgcg acgatgcagc
              19201 atgggcttat ctgagtgaag tcgtctcggg acatccggga tcgatttcaa caatacacgg
              19261 cgcgaatcca atccaaggat tcaagaaact gttttccctt gtcaaaagta gcgcccaagg
              19321 tgctagcttg gaagatcgca cactgattga catgctctct acggcgatcg atgtcatcat
              19381 tccattccgt gcctatgagg acgtttatga agtaggcgag atctggctcg cggcggacgc
              19441 acgacgccgg ggcgagacca taggcgatct ccttaatcaa tagtagctgt aacctcgaag
              19501 cgtttcactt gtaacaacga ttgagaactt ttgtcataaa attgaaatac ttggttcgca
              19561 ttttcgtcat ccgcggtcag ccgcaattct gacgaactgc ccatttagct ggagatgatt
              19621 gtacatcctt cacgtgaaaa tttctcaagc gctgtgaaca agggttcaga ttttagattg
              19681 aaaggtgagc cgttgaaaca cgttcttctt atcgatgacg atgtcgctat gcggcatctt
              19741 attatcgaat accttacgat ccacgccttc aaagtgaccg cggtagccga cagcacccag
              19801 ttcactagag tactctcttc cgcgacggtc gatgtcgtgg ttgttgatct aaatttaggt
              19861 cgtgaagatg ggcttgagat cgttcgaaat ctggcggcaa agtctgatat tccaatcata
              19921 attatcagtg gcgaccgcct tgaggagacg gataaagttg ttgcactcga gctaggagca
              19981 agtgatttta tcgctaagcc gtttagtacg agagagtttc ttgcacgcat tcgggttgcc
              20041 ttgcgcgtgc gccccaacgt tgtccgctcc aaagaccgac ggtctttttg ttttactgac
              20101 tggacactta atctcaggca acgtcgcttg atgtccgaag ctggcggtga ggtgaaactt
              20161 acggcaggtg agttcaatct tctcctcgcg tttttagaga aaccccgcga cgttctatcg
              20221 cgcgagcaac ttctcattgc cagtcgagta cgcgacgagg aggtttacga caggagtata
              20281 gatgttctca ttttgcggct gcgccgcaaa cttgaggcgg atccgtcaag ccctcaactg
              20341 ataaaaacag caagaggtgc cggttatttc tttgacgcgg acgtgcaggt ttcgcacggg
              20401 gggacgatgg cagcctgagc caattgcatt tggctcttaa ttatctggct caaaaggtga
              20461 ctgaggacgc ggccagcggc ctcaaaccta cactcaatat ttggtgaggg gttccgatag
              20521 gtccctcttc accaattgct cgatggcttc tctccagcaa agaatgacgc gagcgcggcg
              20581 gtagccagct tgtggccgaa agctcgagcg gtctccaacc ccaacggatc aaaatgactt
              20641 cgagcgacct cgagcaacgc aaccgggaac atgcgtgagg tctgaacgag aacggatttt
              20701 tctgtagttg aagggatcgg ataacttttc ggggccacgc gaaatgatcc atctgccagc
              20761 atgctttcga aatcgtccaa cgcgcgcctt aaaatcattt gtagcgactt cgagggactg
              20821 tattgccgaa cgaggttgtc atatgttttc gacacttgag gcgcgggcgg tcgcgctgaa
              20881 agaaaaacct ggagcttttt cggggacgga ggtggactaa gggcatccac agttagctta
              20941 agttgtcgat cgggactgta aatgtgatcg gcgacgagag gctcacgttg ctggtctttc
              21001 tcgtcggctt tttcaggcaa gtgctggagg tccagcttct ggggaacaag tgtcgggttg
              21061 ggatggtgga tctcgggtcg agcaccagca agccgccgtg cttcgccgac cgacaatgcg
              21121 ggcttgcgaa ttgccatctt caagcctcca agattttgct gatcagtttc gaaatgacca
              21181 cgacttcctc catcgcaatc cgaagattcc tctctatgag gcgcatcgtc ggatcagttc
              21241 ccgtgtttag taatgtaaga tgcaacatgc cgcgttcttt catcgcggca aatgcatctc
              21301 tttcatgcat gggagacggt acaactggaa ggctctctag cgtctctgac atcctgcgtt
              21361 gcgatgttgt caatcggccg accgggacgc gttggcgcaa aacagctgta ggaattgcca
              21421 aattttcact caacagcagc tcgatgacgt agcggtaggt agatagtgcc tcatcgatgt
              21481 cgagcggcgt tagcatggtg gggatcagaa gcaggtttga gctagcgatg attgtgttgt
              21541 tgagctcgct cgagccgcca cgcgtatcgg ccaacgcata atcaaatcct tcgagctcgg
              21601 cattttcata ggctgcttca agaaggggca tttcgtcggc ggaatagact tcacagcgag
              21661 gatcccaggt actgctttgt aaggcgtttt ctctccatcg cgtcagaggc cggttttcgt
              21721 cggcatcaaa gagggccact cgtttaccgt catttgccaa agcagcgcaa aggcccatga
              21781 gtgcggtggt tttgccagca ccccctttga aagaacaaaa cgtcaaaagt tgcatattct
              21841 gatcccgcct atcctgtgaa accggagtgc atttgtattt ttgttcgtat aaatgttttt
              21901 gtgattatcg atgagtaaaa gcgttgttac actattttta tttcacattc gttataagac
              21961 aattgcaaat gtagcaagta tattcagtat tgactgtaaa tgtactgttg atttcatatt
              22021 gagcagggct agacttccat ccgtctaccc gggcacattt cgtgctggag tatccagacc
              22081 ttccgctttc tttggaggaa gctatgtcaa aacacaccag agccacgtcg agtgagacta
              22141 ccatcaacca gcatcgatcc ctgaaagttg aagggttcaa ggtcgtgagt gcccgtctgc
              22201 gatcggccga gtatgaaacc ttttcctatc aagcgcgcct gctgggactt tcggatagta
              22261 tggcaattcg cgttgcggtg cgccgcatcg ggggctttct cgaaatagat gcagacacac
              22321 gagaaaagat ggaagccata cttcagtcca tcggaatact ctcaagcaat gtatccatgc
              22381 ttctatctgc ctacgccgaa gaccctcgat cggatctgga ggctgtgcga gatgaacgta
              22441 ttgcttttgg cgaggctttc gccgccctcg atggactact gcgctccatt ttgtccgtat
              22501 cccggcgacg gatcgacggt cgctcgttac tgaaaggtgc cttgtagcac ttgaccacgc
              22561 acctgacggg agaaaattgg atgcccgatc gcgctcaagt aatcattcgc attgtgccag
              22621 gaggtggaac caagaccctt cagcagataa tcaatcagct ggagtacctg tcccgaaagg
              22681 gaaagctgga actgcagcgt tcagcccggc atctcgatat tcccgttccg ccggatcaaa
              22741 tccgtgagct tgcccaaagc tgggttacgg aggccgggat ttatgacgaa agtcagtcag
              22801 acgatgacag gcaacaagac ttaacaacac acattattgt aagcttcccc gcaggtaccg
              22861 accaaaccgc agcttatgaa gcaagccggg aatgggcagc cgagatgttt gggtcaggat
              22921 acgggggtgg ccgctataac tatctgacag cctaccacgt cgaccgcgat catccacatt
              22981 tacatgtcgt ggtcaatcgt cgggaacttc tggggcaggg gtggctgaaa atatccaggc
              23041 gccatcccca gctgaattat gacggcttac ggaaaaagat ggcagagatt tcacttcgtc
              23101 acggcatagt cctggatgcg acttcgcgag cagaaagggg aatagcagag cgaccaatca
              23161 catatgctga atatcgacgc cttgagcgga tgcaggctca aaagattcaa ttcgaagata
              23221 cagattttga tgagacctcg cctgaggaag atcgtcggga cctcagtcaa tcgttcgatc
              23281 catttcgatc ggacgcatct gccggcgaac cggaccgtgc aacccgacat gacaaacaac
              23341 cgcttgaacc gcacgcccgt ttccaggagc ccgccggctc cagcatcaaa gccgacgcac
              23401 ggatccgcgt accattggag agcgagcggg gtgcccaacc atccgcgtcc aaaatccctg
              23461 taactgggca tttcgggatt gagacttcgt atgtcgctga agccagcgtg cccaaacaaa
              23521 gcggcaattc cgatacttct cgcccggtga ctgacgttgc catgcacaca gtcgagcgcc
              23581 agcagcgatc aaaacgacgt catgacgagg aggcaggtcc gagcggagca aaccgtaaaa
              23641 gattgaaggc cgcgcaagtt gattccgagg caaatgtcgg tgagcccgac ggtcgcgatg
              23701 acagcaacaa ggcggctgat ccggtgtctg cttccatccg taccgagcaa ccggaagctt
              23761 ctccaacgtg tccgcgtgac cgtcacgatg gagaattggg agaacgcaaa cgtgcaagag
              23821 gtaatcgtcg cgacgatggg cgcgggggga cctagagaca ggaaggaccg aataatggca
              23881 aatggtcagt tcacgatacg ctctgctcgc ccggcctccg tcggactgac aggcgaacgg
              23941 cgtggagccg catccgcctc tagctctgca ctgtccaatg ttcaaagaga tgttagggat
              24001 aggctgattc caactagctc accaagatta ccaaatgcag ccatattgcg tgattcctcg
              24061 ggaagagcgt cgactggtct gcggtacatg gcggctactc ttcattggtc tgcgatcgcg
              24121 ccattatcgc taataaacag caacgacctg gctccggccg cttatgactt tgagacgcga
              24181 aataacgcaa gaaatgtgac tgccaaagtc ggcagggcag tccctgttcc caagcaaggc
              24241 gggctcggca aaacgctcgc acccgtaccc cttagtacac gtatatcaag ggtcaattcc
              24301 gaccgaagac tgcccgctga cgcagaagac cgccctgaaa cgcgcgaccc ccagaaagga
              24361 cgtggcagtc atggtgcgac gccaacctta catgaaaaga ttggaaccgc gtttgctcga
              24421 agattgcgaa agcatacgta ctatattgtt tgcagttgct gccagacccg gagcgcgttg
              24481 acgatgggtg caaagatttc ggtgaagtca tgaactccag caagacttcg ccccagcgta
              24541 tgaccctgag catcgtatgt tcgctggcag ccggtttttg tgcggccagc tgctatgtaa
              24601 cgttccgccg gggcttcaac ggcgaagcga tgatgacgtt cgacgttttc gctttttggt
              24661 atgagacccc gctttacttg ggttatgcca gcaccgtctt ctggcgtggt ttatctgttg
              24721 tcatctttac ctcgctgatc gttctttcaa gtcagctcat catatcgctg cgcaatcaga
              24781 agcatcatgg gacagctcgt tgggcagaaa ttggcgaaat gcggcatgct ggttatctgc
              24841 agcgttacag tcgcatcaag gggccgatct ttggaaagac atgtggtccc ctttggttcg
              24901 gcagttattt gaccaatggc gaacagccac acagtcttgt cgtcgcgcca acgcgtgctg
              24961 gcaaaggcgt cggcatcgtc attccaacgc tgttgacctt caagggctcg gtaatcgccc
              25021 ttgacgtcaa gggagaattg tttgaactga cgtccagagc acgcaaagcg agcggcgacg
              25081 cagttttcaa gttctccccc ctagatcctg agcggaagac tcattgttac aatccggtcc
              25141 tggatattgc cgcacttccg cccgaacgcc agttcactga aacacgccgt ctagctgcga
              25201 accttattac ggctaaggga aagggagcag aaggctttat tgacggcgca cgtgacctgt
              25261 tcgtcgcggg aatccttacc tgcattgagc gtggcacacc aacgattggc gcggtatatg
              25321 acctatttgc gcagcctggc gaaaagtata agctttttgc gcaactcgcg gaggaaagcc
              25381 taaacaaaga ggctcagcgt atcttcgata atatggcggg caacgacacg aaaattctga
              25441 catcgtacac ctctgtgctg ggcgacggtg gactgaacct gtgggctgat ccgcttatca
              25501 aagcagcgac aagccggtca gacttttccg tttacgatct ccggaggaag aagacctgca
              25561 tttatctttg tgtcagtccc aacgatctgg aggtcttggc accacttatg cgcctgatgt
              25621 ttcagcagct cgtgtcaatc ttgcagagat cgctgccagg tgaagacgag tgccatgaag
              25681 ttttatttct cctcgacgaa ttcaaacacc tgggcaagct tgaggccata gagaccgcga
              25741 tcacaaccat cgccggttac agaggccgct ttatgtttat tattcaaagt ctttcggcct
              25801 tgtcgggcac atacgatgac gcaggaaaac aaaactttct gagcaatact ggcgtacaag
              25861 tatttatggc cacggctgat gacgaaactc caacctacat ctcaaaagct atcggcgaat
              25921 atacgtttaa agcgcgttcg acctcttaca gtcaagccag aatgttcgac cacaacatcc
              25981 agatttctga tcaaggtgca gcccttttgc gccccgaaca agtgcgcctg ctagacgatc
              26041 agagtgaaat cgttctcatc aaagggcgac ctccactcaa attacgaaag gtgcagtatt
              26101 attccgatcg tacgctgaaa ggccttttcg aacgccagat gggctctctg cctgagcccg
              26161 cacccttgat gctttccgac tatagcaacg atcaagttca ataccacttg gctccgatag
              26221 caaattttaa tgaggatgct gcaccgcaaa acagaactgt ggccgaggac catggaagtg
              26281 ttaaagtcgg tgctgatatc cctgaacgcg tgatgggaat aaatggtgac gaggaacaag
              26341 ccgatgcggg cgagataccg ccggaatcgg ttgtgcctcc agaattgacg ctcgctctga
              26401 ccgctcaaca gcaattgttg gaccagatta ttgcacttca gcaaagatcg aggtccgcac
              26461 cggcatagcc tgcgaaatga tcttaatggt gcaattcgtt tcaggcggca tgttgcggtt
              26521 caacaaagtg tacgccagat cccaattggc cctttacgag gtgtcggtat gacaggaaag
              26581 tcgaaagttc acataagagg ttcggctgac gcgcttcctg acgttcctgg cggaagtact
              26641 accgcccctt ttttaaccga accttctcgg gatcaggttg atgcctcgtt tgaggtccaa
              26701 accgactaca gccagtctac ttccgtgtcg tttacctatg atggtgttgg acttggtcct
              26761 gccgagcgtg cggcttacga gaactggtgc gaaccgggcc ggcccacttg gaaagatctt
              26821 ataatcaagg cacgtgtcga tccgattgac gatgtgacct ggctccgaga tttagaagag
              26881 gacaccccct caaccttcag atacgaaggg atgcctctgg gcatcgggga acgacaggcc
              26941 tacgaaaatt ggcaagagga cgctcagccg acatgggaag accttgttgt cagcgcacgc
              27001 ttgacggaac ttggccgtcc acacgggatt accggcgagt atacatccct cgcaggatcg
              27061 aagaatacaa gttcaatttc attgaagcga aagcggagca acttaattga tgatgagaat
              27121 tcatccggat cgttttcata tgacgggatg aagctcgggg aagccgagcg ttctgcatat
              27181 ggtgactggg ccgaggcgga gccacccacg tggaaagatt tggtattgag ggcacgcgtt
              27241 tcctcgatca atgactctgc ttggcttttt gattcacaaa catcttcatc atcatttgaa
              27301 tacaacggtg ttcccttggg cgagccggaa cggcaggctc tcagacaatg gcaaggagac
              27361 gctcagccta cctgggaaga tctcgttgtt aacgcgcgta tggcagaact ttgccatgct
              27421 ggttggattg aaggtcaaaa aggttgcttt gaagagcgcg gggaggctct gcccgcgtcg
              27481 gaacgcggtt cgcaacgccc cattggtcaa cggacagatt cctccgattc ttttgtgtat
              27541 gatggcacaa ggctcggagc acctgagcga actgcttatg aacgctggag taagagggaa
              27601 cgcccgactt gggaagatct catcttagat gcacaccagg ccaggactga aagtgacgct
              27661 gttacgaccc aagcgattgg tcagtcgtcc tcaccggttt tcttatatga aggaaagtcg
              27721 ctcggagaca gggaacgaaa ggcttacgaa aaatggcggc agccagccca accgcgatgg
              27781 caaaatcttg tagtgaacgc tcgtctggca gaaatcgatc cctcagcctg gattgccgat
              27841 gagcgcgatc cgcttgatga tagcgacgcg cttggtcgcc cgtcgtacac aagcttgacg
              27901 gatagatcag acgtcccttt agacgatcaa tcaatctatc gtcgttccga cctagtaagg
              27961 gagcaggtgc cagaatcgtc tcaaaggcaa ttcgcagcat gttcagaatc tgaaacgagg
              28021 cctgtgcaat ggtttactgc ttctgggtca gatgcaaaca atacggaaaa tatcaccgcc
              28081 agcgatcccg tcgatcgcac gggtggagtt aagcggctag gctccaaaag cgacagaacc
              28141 gttacagctt ctatccatga cgtgaattcc agcacaaggc gactgttgct taacgaattt
              28201 ggatcggagg ctccgcgccc ttcgccagaa aagactgttc gcttaagaag cgacaatatt
              28261 ggcacctatg ggagccggaa aaatgaacga gcgcggctcg cgaccgaaac cggtgcgtat
              28321 gagtcggagc atattttcgg gttcaaggct gtccacgata ctgcgagagc gacgaaagag
              28381 ggccggcgtc tcgaaaggcc catgcccgcc taccttgagg ataaggggct tcatcgccaa
              28441 catattggca ccgggagagg acggaccaaa cttgtcgggc gcggatggcc ggatgacaca
              28501 agctatcgct cggatcaaag ggcaactctg tcggaccccg ttgcgcgctc ggaaggcgcg
              28561 acggcctcaa atgggtatca attgaaccaa ttgggttacg cgcaccaact cgctagcgat
              28621 ggcctgcaaa gtgaatcgcc cgatggtgtt gccttgccaa ttcaagtggc aacaacgagc
              28681 tacaactata cagtgagccg cgatcctgtc cttgttccgc cggataaaaa cgaagcccct
              28741 caattgctgc atcttggtcc ccgtggtcaa accgaagctg ttcttgcccg cgaaacagca
              28801 ttgactggaa aatggccgac tctcgagcgt gagcagcaag tgtatcgcga gtttttggcc
              28861 ttatatgacg taaaaaaaga tcttgaggcc aaatcagtcg gcgtaagacg gaaaaaaaaa
              28921 gaagttattt ctgcgttaga ccgaactgcg cgcttgataa gcacgtcgcc ttcgaaagct
              28981 cgatccaaag cagagactga aaaagccatt gatgagctcg atgatcgacg agtttatgat
              29041 ccgcgtgatc gagctcaaga caaagcgttt aaacgctgat aagtcgccaa tatagtgatc
              29101 atttgcagta ttcgcatcga tcgctggttg atattctgcc gctggtcgac cggctgctcg
              29161 tcgccaaaaa tgctcacagg gatacgatgg cctcggtcag gccgcgtgcg tcctgtcttt
              29221 ccagttcctc cctttcagct cgattgtggc atcatttatt gcctgctcat tgcagttgaa
              29281 acgcgatatc cgtttcaaga cccgggtatg gatggtactt tggagatatg agcacttgcc
              29341 agacttcccg gtcggagact taaaaattcc gataagaggt tacggacgac ggaccttata
              29401 agtggatcgt ctagtggtgg cgccgatcaa aacagttccg cccccggctt tgctcaaagt
              29461 agcaaagcag ctttatctcg ggttgcggag gattttctag aaaaccgcaa ttttgcagga
              29521 gagaacatat ggccatcatc aagccgcatg tgaacaaaaa taggacaacc tcgccgatag
              29581 agagaccgga gtctctcata gaggaaatga gcggcagtca tccgccgagt ggttttacca
              29641 acctggatct cgctatgatc gagctggagg actttgtcca tcggtgcccg ctcccagaag
              29701 acaatcttgc tggtcagaag gagtgagacg atggatccgt ctagcaatga gaatgtctat
              29761 gtgggtcgcg gtcacaacat cgaaaatgat gatgacactg accccaggcg ttggaagaag
              29821 gcgaatatca gttccaacac catctccgat attcagatga cgaatggcga agacgtacaa
              29881 tcagggagcc ctacccgaac ggaagttgta agcccacgtc tggattatgg atcggtcgac
              29941 tcctcctcca gcctttattc tggcagcgag cacggaaatc aagctgagat tcaaaaagag
              30001 ctgtccgtct tgttctcgaa catgtctttg ccaggcaacg atcggcgccc ggacgaatac
              30061 attctcgtgc atcaaacggg acaagatgct tttactggta ttgccaaagg caacctcgac
              30121 caaatgccca ccaaggcgga atttaacgcg tgctgccgtc tctacaggga cggagccggt
              30181 aattactacc cgccacctct cgcattcgac aagattagcg ttccagagca actggaggaa
              30241 aaatggggga tgatggaggc gaaggaacgt aacaaactgc ggtttcagta caagttggac
              30301 gtatggaatc atgcgcacgc tgatatgggg atcacgggca cagagatctt ttatcaaaca
              30361 gataagaaca taaagctcga ccggaattat aaactaagac ctgaagaccg atacgtacaa
              30421 acagaaaaat acgggcgccg ggaaattcaa aagcgatatc aacacgaact ccaggctggt
              30481 tcgctgctgc ccgatattat gatcaaaact ccccaaaatg acatccactt cgtgtacagg
              30541 tttgccggcg acaattacgc caacaaacag ttcagcgagt ttgaacacac cgtcaagcgc
              30601 aggtatggcg acgagactga gatcaaattg aagtcaaagt caggcattat gcatgactcg
              30661 aaatatctgg aatcctggga acggggcagt gcggatattc gcttcgcgga attcgttggg
              30721 gaaaatagag ctcacaatcg gcagtttcca actgcgacag taaatatggg acagcagcca
              30781 gacgggcagg gcggtttgac ccgcgaccgt catgtgagcg ttgacttcct aatgcaaagc
              30841 gcacccaatt cgccttgggc gcaagctttg aaaaagggag aactgtggga tcgcgttcag
              30901 ttgcttgctc gcgacggcaa ccgctatctg tcgccgccca gattggaata ttctgaccct
              30961 gcacatttca ccgagttgat gaaccgggtt ggtttacccg catcgatggg tcggcaaagc
              31021 catgcggcta gtatcaaatt cgaaaagttt gacgcgcagg cagcggttat tgtcttaaat
              31081 ggcccagagt tacgtgacat tcatgacttg tctcctgaaa aactgcaaaa tttgtccacc
              31141 aaagatgtca tcgtcgccga tcgcaatgag aatggtcaga gaactggcac gtacaccagc
              31201 gtcgcggaat atgagcgctt gcagttaagg ctgccacccg atgcagcggg ggtgcttggt
              31261 gaagcaactg acaaatattc acgtgatttc gttcggccag agccggcgtc gcgtccaatc
              31321 agtgacagcc gcaggatata cgaaagtcga ccgcgtagcc aaagcgtcaa cagcttttga
              31381 cgttcctgct gccgcgtcaa cgaggaagct cgtttgaccc gggtttgcca atgaaagggc
              31441 tcaatcatgg tgaacactac aaagaaaagt tttgcgaagt cgcttacggc agatatgcgc
              31501 cgttctgctc agcgcgttgt cgagcaaatg cgaaaagcat tgattaccga agaagaggcg
              31561 ctcaagcggc aagccagact ggagagtccc gataggaagc gaaagtatgc tgctgatatg
              31621 gcgatagtcg acaaactcga cgtagggttt cgaggcgaaa taggctataa aattcttgga
              31681 aataaccggc ttcgagtaga caaccataaa gaattaacgc gtgagcacgg tagacttcgc
              31741 aaaaccaaaa cggttctgaa gcgtaacccg gtgacgcagg aagtctattt gggtttatat
              31801 gaaaggaagt cctggttaag tgtcagcagc catttgtatg ctgcggacgg cacactccgc
              31861 atgaagcacg tgaaatacaa agacggacgt tttgaggaaa aatgggagcg cgacgaaaat
              31921 ggcgacctga tccgcacaag gtacgccaac cgtggcaggc tctttcaacc tgtatccgag
              31981 aaaatgggcg cgccgtatcg gagcggccct gacgaccggc tctatcgcga tctaacccgt
              32041 cgaaacggtt tcagacggga gacattcgaa cgggacgatc acggaaacct cgagcgtatc
              32101 ggcagcaacc atgtcggctt ttccaagatt tcagtgaagg cacccaatcg tcaaacctcc
              32161 cagacgaaga ttcaaaaact tggtggcgct ttcaacaaat cttttaggtc ccttctggac
              32221 aaggagggca atgaaatggg ccgcgatatt ttgagccatc gacggctcta taacaagcgg
              32281 tctgctgtct acgatgaagc taccggacaa ttgaagagtg ccaagcatac cttcggcaag
              32341 atctacagga gcgaaaccga atatctcagc gcgggcctca agaaggtttc aaaaaagata
              32401 ctcggggtga cggtctaccg gaaatttgcg gcgctcagcg agcgagaatc cgaggctgag
              32461 agactgcgta gttttgaatc cggtgcgcat cgccagatct ggcaggagcg ggcagcgatt
              32521 cccggttcgc ccctcccgga gactgatgac attcatttcg cacagcagtc gcacctagcc
              32581 aaagccaacc ctgatcacgt cgaagctgac gtcacgcgtg tgacagatca acatgttgat
              32641 gttgctggac aaacatcatc gtctccccaa cggaacttgg aaggatggtt agattctcaa
              32701 tcacgataca agccagcaaa catgctgttg tcaaatccag accttcaagc gaacggacct
              32761 cgcccatacg aagggttagc tcatctcacc ctccggcgcg ataatgaatc tgacgggcac
              32821 aaggagaatg atcagcggct gcgacatttc tcccagccag agccgttggt gttaccgcat
              32881 cccgggtcgc cggaaataac taaggtgttt ggctcgcggg gagagccggc acacccgagt
              32941 ggaaatctgc acacggcggt tggagaaacg gcttgcgaag gaccggtgat gtcttcatcc
              33001 tcggacaatc atcagccagc tccaggacag caagaacttt taagtttcct tcataatgcg
              33061 ccagccccag tttctgtggc aatacatgat gatcaagagc gacttgcggg ggaggcgccc
              33121 ggcggctctt tcagaggtag ctcagggcga acgagttcaa tgtcggagag tatcttcgac
              33181 gaagatgtac aagggcattt ggtacgggat tattcgatca atactactaa cgggtttatt
              33241 gacccgcaat cgttgttcgg tgaaccggac ttatcgagag gtccaaaatc ggggccagaa
              33301 attccatcgg aagattacca tttgtcagct tcggaacagg aaaatttgct gaatcaattg
              33361 cttagtgtgc cactgccggt tccttcaccg aagcccgaat gcgcgaggtc tatgattttc
              33421 gaaggttcac gttcaagaga gcgttccacc tccagagggt tctaaggtgg aacgcgtcta
              33481 ggcttgccta tcatcaccac ctcatgatgg tcgcggagac cttcgaagag atatccgaca
              33541 tcattggaga agctgggccg gaaactgggc ttcttcttga caccggacac gccgcggcag
              33601 ccggattcga ctacgcgaag ctcatcgagc ggttcggcga ccgcatcgtt catattcatc
              33661 tgaaggacgt tcgcaaggca agccgcgccg aggtccagtc aaaggatctc ccatcggttg
              33721 acgaaaagac atgattttcg ttaagcgcgt cgcagggcaa ggccgcaatc gcccgcagca
              33781 aagggccggc aattgaggtt ggccccgcta ccccctatca gattgtcgcc gacatcatca
              33841 gacgagattg gcaaaagctg cagctggtat gctgctatgc ggcaaatcaa gacggtggtc
              33901 gatcgtctcg agcggttgag tgcggcggcc agagcgagcc agaccaactt tttgtcgaac
              33961 tgttcgcaga agatgggccg cccgcaggga actgcatcgc accagaaccg acgcgaccat
              34021 caagtctgct cgcggaccgc tgaggtgcag gtcagcgggc cgacgcagat atcggctttg
              34081 aacgttggct cccgcagacg gggctcgcgg ggtcgtcgca aagacttctc tgtacgtatt
              34141 cgtgatgaga tgatttgtct ctgtatgcag attgcgatgc gggatcaaac tgcaatcccc
              34201 cggaagcaca atgggcctgc atcaggatga tcgcggctcg atcggaaaca caagcagtgt
              34261 cgaggttgcg gacgcacaga gccggccatc cgagtcgact agccgcgctt cggagaaggc
              34321 aacccgtcga ccaagtgaca caatctttcc ttcagcccgg accttcccgc tgctctcact
              34381 caaggcgcga tgatacgcca ctttcaattc aagcgtcgta tagccctggc ctgccggaag
              34441 gaccgaatgc acggcgcagc cacaggcgct gtcgagtagt gtcgcggcat agccgccatg
              34501 caccgagccg atcggattga agaccttgcg tgacggcgat ccttcgaaca ccacccgtcc
              34561 gcgctcgagt tcgacaagag caaactccag cgtctcaccg atcggcggct gaataccggc
              34621 ctgcatgagg gccgccaatt ggtcgtgacc gtcgaggcca tggttgcttt caaggatgtt
              34681 catgccgcac gccttttctg cgcggggtcg gcgcgttggg cgtctttttt tcgtcgatcc
              34741 acacccgcgt ctcggacagg acctcgtccg gcagtgtgga atcatcaatc gaccgggcga
              34801 ggatgagcgc accaaccatc gcagaccagc tgccgatggc agctctacgg cgtttgacag
              34861 gatcaacacc cggtatcatc tcggtcagag tgtcaatctg cgcggctaga acctgcgcca
              34921 tcgaagcgcg tgcctctgga gcctgttgcc gcatgaaacc cgcgagagcg gccatggggc
              34981 aacccatatc cgcatgctca cgatggggtt tcgagagata ggtgtcgatc caggcgctga
              35041 gatcgccgat ccctgattga ctgcctgcgg catgcgcgat ggtttgggcg accagatcgt
              35101 ccttcgatcg gaaatgcccg taaaagccgc cgtgggtcat gccggcggcg ttcatcactt
              35161 cggcgacgct taccgcatcg aaacccttct cgcggaacag gcgtcccgcc tcggtcagga
              35221 tgcggccgct cgagcatgca tctagagggc ccaattcgcc ctatagtgag tcgtattaca
              35281 attcactggc cgtcgtttta caacgtcgtg actgggaaaa ccctggcgtt acccaactta
              35341 atcgccttgc agcacatccc cctttcgcca gctggcgtaa tagcgaagag gcccgcaccg
              35401 atcgcccttc ccaacagttg cgcagcctga atggcgaatg gacgcgccct gtagcggcgc
              35461 attaagcgcg gcgggtgtgg tggttacgcg cagcgtgacc gctacacttg ccagcgccct
              35521 agcgcccgct cctttcgctt tcttcccttc ctttctcgcc acgttcgccg gctttccccg
              35581 tcaagctcta aatcgggggc tccctttagg gttccgattt agagctttac ggcacctcga
              35641 ccgcaaaaaa cttgatttgg gtgatggttc acgtagtggg ccatcgccct gatagacggt
              35701 ttttcgccct ttgacgttgg agtccacgtt ctttaatagt ggactcttgt tccaaactgg
              35761 aacaacactc aaccctatcg cggtctattc ttttgattta taagggattt tgccgatttc
              35821 ggcctattgg ttaaaaaatg agctgattta acaaattcag ggcgcaaggg ctgctaaagg
              35881 aaccggaaca cgtagaaagc cagtccgcag aaacggtgct gaccccggat gaatgtcagc
              35941 tactgggcta tctggacaag ggaaaacgca agcgcaaaga gaaagcaggt agcttgcagt
              36001 gggcttacat ggcgatagct agactgggcg gttttatgga cagcaagcga accggaattg
              36061 ccagctgggg cgccctctgg taaggttggg aagccctgca aagtaaactg gatggctttc
              36121 ttgccgccaa ggatctgatg gcgcagggga tcaagatctg atcaagagac aggatgagga
              36181 tcgtttcgca tgattgaaca agatggattg cacgcaggtt ctccggccgc ttgggtggag
              36241 aggctattcg gctatgactg ggcacaacag acaatcggct gctctgatgc cgccgtgttc
              36301 cggctgtcag cgcaggggcg cccggttctt tttgtcaaga ccgacctgtc cggtgccctg
              36361 aatgaactgc aggacgaggc agcgcggcta tcgtggctgg ccacgacggg cgttccttgc
              36421 gcagctgtgc tcgacgttgt cactgaagcg ggaagggact ggctgctatt gggcgaagtg
              36481 ccggggcagg atctcctgtc atcccacctt gctcctgccg agaaagtatc catcatggct
              36541 gatgcaatgc ggcggctgca tacgcttgat ccggctacct gcccattcga ccaccaagcg
              36601 aaacatcgca tcgagcgagc acgtactcgg atggaagccg gtcttgtcga tcaggatgat
              36661 ctggacgaag agcatcaggg gctcgcgcca gccgaactgt tcgccaggct caaggcgcgc
              36721 atgcccgacg gcgaggatct cgtcgtgacc catggcgatg cctgcttgcc gaatatcatg
              36781 gtggaaaatg gccgcttttc tggattcatc gactgtggcc ggctgggtgt ggcggaccgc
              36841 tatcaggaca tagcgttggc tacccgtgat attgctgaag agcttggcgg cgaatgggct
              36901 gaccgcttcc tcgtgcttta cggtatcgcc gctcccgatt cgcagcgcat cgccttctat
              36961 cgccttcttg acgagttctt ctgaattgaa aaaggaagag tatgagtatt caacatttcc
              37021 gtgtcgccct tattcccttt tttgcggcat tttgccttcc tgtttttgct cacccagaaa
              37081 cgctggtgaa agtaaaagat gctgaagatc agttgggtgc acgagtgggt tacatcgaac
              37141 tggatctcaa cagcggtaag atccttgaga gttttcgccc cgaagaacgt tttccaatga
              37201 tgagcacttt taaagttctg ctatgtcata cactattatc ccgtattgac gccgggcaag
              37261 agcaactcgg tcgccgggcg cggtattctc agaatgactt ggttgagtac tcaccagtca
              37321 cagaaaagca tcttacggat ggcatgacag taagagaatt atgcagtgct gccataacca
              37381 tgagtgataa cactgcggcc aacttacttc tgacaacgat cggaggaccg aaggagctaa
              37441 ccgctttttt gcacaacatg ggggatcatg taactcgcct tgatcgttgg gaaccggagc
              37501 tgaatgaagc cataccaaac gacgagagtg acaccacgat gcctgtagca atgccaacaa
              37561 cgttgcgcaa actattaact ggcgaactac ttactctagc ttcccggcaa caattaggat
              37621 gacagagcgt tgctgcctgt gatcaattcg ggcacgaacc cagtggacat aagcctcgtt
              37681 cggttcgtaa gctgtaatgc aagtagcgta actgccgtca cgcaactggt ccagaacctt
              37741 gaccgaacgc agcggtggta acggcgcagt ggcggttttc atggcttctt gttatgacat
              37801 gtttttttgg ggtacagtct atgcctcggg catccaagca gcaagcgcgt tacgccgtgg
              37861 gtcgatgttt gatgttatgg agcagcaacg atgttacgca gcagggcagt cgccctaaaa
              37921 caaagttaaa catcatgggg gaagcggtga tcgccgaagt atcgactcaa ctatcagagg
              37981 tagttggcgt catcgagcgc catctcgaac cgacgttgct ggccgtacat ttgtacggct
              38041 ccgcagtgga tggcggcctg aagccacaca gtgatattga tttgctggtt acggtgaccg
              38101 taaggcttga tgaaacaacg cggcgagctt tgatcaacga ccttttggaa acttcggctt
              38161 cccctggaga gagcgagatt ctccgcgctg tagaagtcac cattgttgtg cacgacgaca
              38221 tcattccgtg gcgttatcca gctaagcgcg aactgcaatt tggagaatgg cagcgcaatg
              38281 acattcttgc aggtatcttc gagccagcca cgatcgacat tgatctggct atcttgctga
              38341 caaaagcaag agaacatagc gttgccttgg taggtccagc ggcggaggaa ctctttgatc
              38401 cggttcctga acaggatcta tttgaggcgc taaatgaaac cttaacgcta tggaactcgc
              38461 cgcccgactg ggctggcgat gagcgaaatg tagtgcttac gttgtcccgc atttggtaca
              38521 gcgcagtaac cggcaaaatc gcgccgaagg atgtcgctgc cgactgggca atggagcgcc
              38581 tgccggccca gtatcagccc gtcatacttg aagctagaca ggcttatctt ggacaagaag
              38641 aagatcgctt ggcctcgcgc gcagatcagt tggaagaatt tgtccactac gtgaaaggcg
              38701 agatcaccaa ggtagtcggc aaataatgtc tagctagaaa ttcgttcaag ccgacgccgc
              38761 ttcgccggcg ttaactcaag cgattagatg cactaagcac ataattgctc acagccaaac
              38821 tatcaggtca agtctgcttt tattattttt aagcgtgcat aataagccct acacaaattg
              38881 ggagatatat catgcatgac caaaatccct taacgtgagt tttcgttcca ctgagcgtca
              38941 gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg cgtaatctgc
              39001 tgcttgcaaa caaaaaaacc accgctacca gcggtggttt gtttgccgga tcaagagcta
              39061 ccaactcttt ttccgaaggt aactggcttc agcagagcgc agataccaaa tactgtcctt
              39121 ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc tacatacctc
              39181 gctctgctaa tcctgttacc agtggctgct gccagtggcg ataagtcgtg tcttaccggg
              39241 ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac ggggggttcg
              39301 tgcacacagc ccagcttgga gcgaacgacc tacaccgaac tgagatacct acagcgtgag
              39361 ctatgagaaa gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc
              39421 agggtcggaa caggagagcg cacgagggag cttccagggg gaaacgcctg gtatctttat
              39481 agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg
              39541 gggcggagcc tatggaaaaa cgccagcaac gcggcctttt tacggttcct ggccttttgc
              39601 tggccttttg ctcacatgtt ctttcctgcg ttatcccctg attctgtgga taaccgtatt
              39661 accgcctttg agtgagctga taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca
              39721 gtgagcgagg aagcggaaga gcgcctgatg cggtattttc tccttacgca tctgtgcggt
              39781 atttcacacc gcatatggtg cactctcagt acaatctgct ctgatgccgc atagttaagc
              39841 cagtatacac tccgctatcg ctacgtgact gggtcatggc tgcgccccga cacccgccaa
              39901 cacccgctga cgcgccctga cgggcttgtc tgctcccggc atccgcttac agacaagctg
              39961 tgaccgtctc cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga
              40021 ggcagggtgc cttgatgtgg gcgccggcgg tcgagtggcg acggcgcggc ttgtccgcgc
              40081 cctggtagat tgcctggccg taggccagcc atttttgagc ggccagcggc cgcgataggc
              40141 cgacgcgaag cggcggggcg tagggagcgc agcgaccgaa gggtaggcgc tttttgcagc
              40201 tcttcggctg tgcgctggcc agacagttat gcacaggcca ggcgggtttt aagagtttta
              40261 ataagtttta aagagtttta ggcggaaaaa tcgccttttt tctcttttat atcagtcact
              40321 tacatgtgtg accggttccc aatgtacggc tttgggttcc caatgtacgg gttccggttc
              40381 ccaatgtacg gctttgggtt cccaatgtac gtgctatcca caggaaagag accttttcga
              40441 cctttttccc ctgctagggc aatttgccct agcatctgct ccgtacatta ggaaccggcg
              40501 gatgcttcgc cctcgatcag gttgcggtag cgcatgacta ggatcgggcc agcctgcccc
              40561 gcctcctcct tcaaatcgta ctccggcagg tcatttgacc cgatcagctt gcgcacggtg
              40621 aaacagaact tcttgaactc tccggcgctg ccactgcgtt cgtagatcgt cttgaacaac
              40681 catctggctt ctgccttgcc tgcggcgcgg cgtgccaggc ggtagagaaa acggccgatg
              40741 ccgggatcga tcaaaaagta atcggggtga accgtcagca cgtccgggtt cttgccttct
              40801 gtgatctcgc ggtacatcca atcagctagc tcgatctcga tgtactccgg ccgcccggtt
              40861 tcgctcttta cgatcttgta gcggctaatc aaggcttcac cctcggatac cgtcaccagg
              40921 cggccgttct tggccttctt cgtacgctgc atggcaacgt gcgtggtgtt taaccgaatg
              40981 caggtttcta ccaggtcgtc tttctgcttt ccgccatcgg ctcgccggca gaacttgagt
              41041 acgtccgcaa cgtgtggacg gaacacgcgg ccgggcttgt ctcccttccc ttcccggtat
              41101 cggttcatgg attcggttag atgggaaacc gccatcagta ccaggtcgta atcccacaca
              41161 ctggccatgc cggccggccc tgcggaaacc tctacgtgcc cgtctggaag ctcgtagcgg
              41221 atcacctcgc cagctcgtcg gtcacgcttc gacagacgga aaacggccac gtccatgatg
              41281 ctgcgactat cgcgggtgcc cacgtcatag agcatcggaa cgaaaaaatc tggttgctcg
              41341 tcgcccttgg gcggcttcct aatcgacggc gcaccggctg ccggcggttg ccgggattct
              41401 ttgcggattc gatcagcggc cgcttgccac gattcaccgg ggcgtgcttc tgcctcgatg
              41461 cgttgccgct gggcggcctg cgcggccttc aacttctcca ccaggtcatc acccagcgcc
              41521 gcgccgattt gtaccgggcc ggatggtttg cgaccgctca cgccgattcc tcgggcttgg
              41581 gggttccagt gccattgcag ggccggcaga caacccagcc gcttacgcct ggccaaccgc
              41641 ccgttcctcc acacatgggg cattccacgg cgtcggtgcc tggttgttct tgattttcca
              41701 tgccgcctcc tttagccgct aaaattcatc tactcattta ttcatttgct catttactct
              41761 ggtagctgcg cgatgtattc agatagcagc tcggtaatgg tcttgccttg gcgtaccgcg
              41821 tacatcttca gcttggtgtg atcctccgcc ggcaactgaa agttgacccg cttcatggct
              41881 ggcgtgtctg ccaggctggc caacgttgca gccttgctgc tgcgtgcgct cggacggccg
              41941 gcacttagcg tgtttgtgct tttgctcatt ttctctttac ctcattaact caaatgagtt
              42001 ttgatttaat ttcagcggcc agcgcctgga cctcgcgggc agcgtcgccc tcgggttctg
              42061 attcaagaac ggttgtgccg gcggcggcag tgcctgggta gctcacgcgc tgcgtgatac
              42121 gggactcaag aatgggcagc tcgtacccgg ccagcgcctc ggcaacctca ccgccgatgc
              42181 gcgtgccttt gatcgcccgc gacacgacaa aggccgcttg tagccttcca tccgtgacct
              42241 caatgcgctg cttaaccagc tccaccaggt cggcggtggc ccatatgtcg taagggcttg
              42301 gctgcaccgg aatcagcacg aagtcggctg ccttgatcgc ggacacagcc aagtccgccg
              42361 cctggggcgc tccgtcgatc actacgaagt cgcgccggcc gatggccttc acgtcgcggt
              42421 caatcgtcgg gcggtcgatg ccgacaacgg ttagcggttg atcttcccgc acggccgccc
              42481 aatcgcgggc actgccctgg ggatcggaat cgactaacag aacatcggcc ccggcgagtt
              42541 gcagggcgcg ggctagatgg gttgcgatgg tcgtcttgcc tgacccgcct ttctggttaa
              42601 gtacagcgat aaccttcatg cgttcccctt gcgtatttgt ttatttactc atcgcatcat
              42661 atacgcagcg accgcatgac gcaagctgtt ttactcaaat acacatcacc tttttagacg
              42721 gcggcgctcg gtttcttcag cggccaagct ggccggccag gccgccagct tggcatcaga
              42781 caaaccggcc aggatttcat gcagccgcac ggttgagacg tgcgcgggcg gctcgaacac
              42841 gtacccggcc gcgatcatct ccgcctcgat ctcttcggta atgaaaaacg gttcgtcctg
              42901 gccgtcctgg tgcggtttca tgcttgttcc tcttggcgtt cattctcggc ggccgccagg
              42961 gcgtcggcct cggtcaatgc gtcctcacgg aaggcaccgc gccgcctggc ctcggtgggc
              43021 gtcacttcct cgctgcgctc aagtgcgcgg tacagggtcg agcgatgcac gccaagcagt
              43081 gcagccgcct ctttcacggt gcggccttcc tggtcgatca gctcgcgggc gtgcgcgatc
              43141 tgtgccgggg tgagggtagg gcgggggcca aacttcacgc ctcgggcctt ggcggcctcg
              43201 cgcccgctcc gggtgcggtc gatgattagg gaacgctcga actcggcaat gccggcgaac
              43261 acggtcaaca ccatgcggcc ggccggcgtg gtggtgtcgg cccacggctc tgccaggcta
              43321 cgcaggcccg cgccggcctc ctggatgcgc tcggcaatgt ccagtaggtc gcgggtgctg
              43381 cgggccaggc ggtctagcct ggtcactgtc acaacgtcgc cagggcgtag gtggtcaagc
              43441 atcctggcca gctccgggcg gtcgcgcctg gtgccggtga tcttctcgga aaacagcttg
              43501 gtgcagccgg ccgcgtgcag ttcggcccgt tggttggtca agtcctggtc gtcggtgctg
              43561 acgcgggcat agcccagcag gccagcggcg gcgctcttgt tcatggcgta atgtctccgg
              43621 ttctagtcgc aagtattcta ctttatgcga ctaaaacacg cgacaagaaa acgccaggaa
              43681 aagggcaggg cggcagcctg tcgcgtaact taggacttgt gcgacatgtc gttttcagaa
              43741 gacggctgca ctgaacgtca gaagccgact gcactatagc agcggagggg ttggatcaaa
              43801 gtactttgat cccgagggga accctgtggt tggcatgcac atacaaatgg acgaacggat
              43861 aaaccttttc acgccctttt aaatatccgt tattctaata aacgctcttt tctcttaggt
              43921 ttacccgcca atatatcctg tcaaacactg atagtttaat tcccgatcta gtaacataga
              43981 tgacaccgcg cgcgataatt tatcctagtt tgcgcgctat attttgtttt ctatcgcgta
              44041 ttaaatgtat aattgcggga ctctaatcat aaaaacccat ctcataaata acgtcatgca
              44101 ttacatgtta attattacat gcttaacgta attcaacaga aattatatga taatcatcgc
              44161 aagaccggca acaggattca atcttaagaa actttattgc caaatgtttg aacgatcggg
              44221 gaaattcgag ctggtcacca attcacacgt gatggtgatg gtgatggcta gcgttcttgt
              44281 agccgaaatc tggaatgttg gtccagcgct cgcgaaagac gtgcgcggcg agcttcggct
              44341 tgcggtcacg agtgaacacg cccttcttgt ttccttggac gcgcatcacg ccctgagagg
              44401 tcgcgaagtc cgcgaagttc cacgcttgct cacccacgaa gttctcaaac tcatcgaaca
              44461 cgacgtggtt cgcctggtag tactcgactt gatattcctc ggtgaacatc actggatcaa
              44521 tgtcgtgaaa gcccgcaacg gtgtctgcgc cgtactcagt gatcatgatc ggctttcctg
              44581 ggcaacgctt gttccacgcg tgaaattcct ggcggagatg gactttggcc gcttcgagat
              44641 caccgccatc gaagtaccat ccgttatagc gattgagcgc gatgacgtca atcagttcgg
              44701 cgactttgtc cgtctccggg gtagccatca caaacagcac gatcgtgacc ggacgcttct
              44761 gtgggtcgag ttccttggtc agctccacca acggcttgaa gtactcgtac gcgccctctt
              44821 cctcagtcgc cgcctcgttg gcgatgctcc acatcacgac gcttggatgg ttcttgtcac
              44881 gagacaccag ttcacggaga acgtcttgat ggtgctcaaa cgtccgaatc ttctcccagg
              44941 tactgacgcg ctcgctgcct tcgccgagtc ccgtggtggc catgaagttg aggtgcacgc
              45001 caactgccgg agtctcgtcg atcacgacca gaccctcgcg atccgcaaga cgcatcaact
              45061 cttcagagta cggatagtgt gcggtccgga agctgttggc gccgatccat ttgaggatat
              45121 tgaaatccat cacattgctc gcttcgttaa agccacggcc gttgatagga gtgtcctcat
              45181 gtttgccaaa gcccttgaag tagaacggtt tgttgttgat gaggaacttg ccgtcgttga
              45241 cttccacggt ccgcacgccg aacggctctt catagacatc gatggtcagt ccgtcgttca
              45301 ccagttccac tttgatctgg tagagatacg tgttcagtgg ttcccagagg atgacattcg
              45361 gaatctccac gttaccgctc aggccctcgg tgcttgcgac cactttgcct tcctcatcca
              45421 cgaccgacac tttcacggtc tcggctttgc cttgaaagtc caccgtatag gtcacagtcc
              45481 cggttgggcc attgaagtcg gtcacaaccg agatgtcctc gacgtacgta aacggggtcg
              45541 tgtagatttt caccggacgg tgcaggcctg catagttgaa gaagtcgaag ttcggcttgt
              45601 tacgaatgac ttttccgagg ccctcttcgt ggcgctcgct gtacagcccc accgggaggg
              45661 tgctatcgtc gaggatgttg tccacggcga cggtgacgcg attcatgcca tcacgcagcg
              45721 agttgttgat ttccgcttcg aatggcagga atccgccctt gtgctccacg accagctcac
              45781 cattgacata gacaattgct ttgtgagttg cagagccgaa gcggagcacg atacgctgat
              45841 ccttcagata ggccggcacc gtgaactcac gttcgtacca gacatatccg atatggttgc
              45901 ggatttcctt ggtcacgcca atgtcattgt aactgcttgg gacggccata ctaatagtgt
              45961 cggtcagctt gctttcgtac cacttctctt ccagtccttt cccgtagtcc agcttgaagt
              46021 tccagacgcc attgaggtcg aagacgccac gggtctcggt gttgatcggg tacagactag
              46081 ttcgtcggtt ctgtaactat catcatcatc atagacacac gaaataaagt aatcagatta
              46141 tcagttaaag ctatgtaata tttacaccat aaccaatcaa ttaaaaaata gatcagttta
              46201 aagaaagatc aaagctcaaa aaaataaaaa gagaaaaggg tcctaaccaa gaaaatgaag
              46261 gagaaaaact agaaatttac cctcagatct accatggtca agagtccccc gtgttctctc
              46321 caaatgaaat gaacttcctt atatagagga agggtcttgc gaaggatagt gggattgtgc
              46381 gtcatccctt acgtcagtgg agatatcaca tcaatccact tgctttgaag acgtggttgg
              46441 aacgtcttct ttttccacga tgctcctcgt gggtgggggt ccatctttgg gaccactgtc
              46501 ggcagaggca tcttcaacga tggcctttcc tttatcgcaa tgatggcatt tgtaggagcc
              46561 accttccttt tccactatct tcacaataaa gtgacagata gctgggcaat ggaatccgag
              46621 gaggtttccg gatattaccc tttgttgaaa agtctcaatt gccctttggt cttctgagac
              46681 tgtatctttg atatttttgg agtagacaag tgtgtcgtgc tccaccatgt tgacgaagat
              46741 tttcttcttg tcattgagtc gtaagagact ctgtatgaac tgttcgccag tctttacggc
              46801 gagttctgtt aggtcctcta tttgaatctt tgactccatg aagctaaact gaaggcggga
              46861 aacgacaatc tgatccaagc tcaagctgct ctagcattcg ccattcaggc tgcgcaactg
              46921 ttgggaaggg cgatcggtgc gggcctcttc gctattacgc cagctggcga aagggggatg
              46981 tgctgcaagg cgattaagtt gggtaacgcc agggttttcc cagtcacgac gttgtaaaac
              47041 gacggccagt gccaagcttc ctgcaggcct aggatttaaa tggtctagag gatccccggg
              47101 taccgagctc gaattcgtaa tcatggtcat agctgtttcc tgtgtgaaat tgttatccgc
              47161 tcacaattcc acacaacata cgagccggaa gcataaagtg taaagcctgg ggtgcctaat
              47221 gagtgagcta actcacatta attgcgttgc gctcactgcc cgctttccag tcgggaaacc
              47281 tgtcgtgcca gctgcattaa tgaatcggcc aacgcgcggg gagaggcggt ttgcgtattg
              47341 gctagagcag cttgccaaca tggtggagca cgacactctc gtctactcca agaatatcaa
              47401 agatacagtc tcagaagacc aaagggctat tgagactttt caacaaaggg taatatcggg
              47461 aaacctcctc ggattccatt gcccagctat ctgtcacttc atcaaaagga cagtagaaaa
              47521 ggaaggtggc acctacaaat gccatcattg cgataaagga aaggctatcg ttcaagatgc
              47581 ctctgccgac agtggtccca aagatggacc cccacccacg aggagcatcg tggaaaaaga
              47641 agacgttcca accacgtctt caaagcaagt ggattgatgt gataacatgg tggagcacga
              47701 cactctcgtc tactccaaga atatcaaaga tacagtctca gaagaccaaa gggctattga
              47761 gacttttcaa caaagggtaa tatcgggaaa cctcctcgga ttccattgcc cagctatctg
              47821 tcacttcatc aaaaggacag tagaaaagga aggtggcacc tacaaatgcc atcattgcga
              47881 taaaggaaag gctatcgttc aagatgcctc tgccgacagt ggtcccaaag atggaccccc
              47941 acccacgagg agcatcgtgg aaaaagaaga cgttccaacc acgtcttcaa agcaagtgga
              48001 ttgatgtgat atctccactg acgtaaggga tgacgcacaa tcccactatc cttcgcaaga
              48061 ccttcctcta tataaggaag ttcatttcat ttggagagga cacgctgaaa tcaccagtct
              48121 ctctctacaa atctatctct ctcgagcttt cgcagatccc ggggggcaat gagatatgaa
              48181 aaagcctgaa ctcaccgcga cgtctgtcga gaagtttctg atcgaaaagt tcgacagcgt
              48241 ctccgacctg atgcagctct cggagggcga agaatctcgt gctttcagct tcgatgtagg
              48301 agggcgtgga tatgtcctgc gggtaaatag ctgcgccgat ggtttctaca aagatcgtta
              48361 tgtttatcgg cactttgcat cggccgcgct cccgattccg gaagtgcttg acattgggga
              48421 gtttagcgag agcctgacct attgcatctc ccgccgtgca cagggtgtca cgttgcaaga
              48481 cctgcctgaa accgaactgc ccgctgttct acaaccggtc gcggaggcta tggatgcgat
              48541 cgctgcggcc gatcttagcc agacgagcgg gttcggccca ttcggaccgc aaggaatcgg
              48601 tcaatacact acatggcgtg atttcatatg cgcgattgct gatccccatg tgtatcactg
              48661 gcaaactgtg atggacgaca ccgtcagtgc gtccgtcgcg caggctctcg atgagctgat
              48721 gctttgggcc gaggactgcc ccgaagtccg gcacctcgtg cacgcggatt tcggctccaa
              48781 caatgtcctg acggacaatg gccgcataac agcggtcatt gactggagcg aggcgatgtt
              48841 cggggattcc caatacgagg tcgccaacat cttcttctgg aggccgtggt tggcttgtat
              48901 ggagcagcag acgcgctact tcgagcggag gcatccggag cttgcaggat cgccacgact
              48961 ccgggcgtat atgctccgca ttggtcttga ccaactctat cagagcttgg ttgacggcaa
              49021 tttcgatgat gcagcttggg cgcagggtcg atgcgacgca atcgtccgat ccggagccgg
              49081 gactgtcggg cgtacacaaa tcgcccgcag aagcgcggcc gtctggaccg atggctgtgt
              49141 agaagtactc gccgatagtg gaaaccgacg ccccagcact cgtccgaggg caaagaaata
              49201 gagtagatgc cgaccggatc tgtcgatcga caagctcgag tttctccata ataatgtgtg
              49261 agtagttccc agataaggga attagggttc ctatagggtt tcgctcatgt gttgagcata
              49321 taagaaaccc ttagtatgta tttgtatttg taaaatactt ctatcaataa aatttctaat
              49381 tcctaaaacc aaaatccagt actaaaatcc agatcccccg aattaattcg gcgttaattc
              49441 agtacattaa aaacgtccgc aatgtgttat taagttgtct aagcgtcaat ttgtttacac
              49501 cacaatatat cctgccacca gccagccaac agctccccga ccggcagctc ggcacaaaat
              49561 caccactcga tacaggcagc ccatcagtcc gggacggcgt cagcgggaga gccgttgtaa
              49621 ggcggcagac tttgctcatg ttaccgatgc tattcggaag aacggcaact aagctgccgg
              49681 gtttgaaaca cggatgatct cgcggagggt agcatgttga ttgtaacgat gacagagcgt
              49741 tgctgcctgt gatcacc








          Copyright © 20012-2013 BIOFENG. 生物風 版權所有 Powered by Biofeng
            <pre id="q7rs8"><label id="q7rs8"><menu id="q7rs8"></menu></label></pre>

              1. <pre id="q7rs8"></pre>
                <track id="q7rs8"><ruby id="q7rs8"></ruby></track>
                <acronym id="q7rs8"><label id="q7rs8"></label></acronym>

                  免费高清视频 成人免费视频 成年在线视频免费观看视频


                  免费高清视频 成人免费视频 成年在线视频免费观看视频